trRosettaRNA results for the example job (your_RNA)

Download all modeling results: example_results.tar.bz2 (Note: this page will be removed after one month to save computer space)

   Predicted structure model
Color by:

Color by pLDDT from orange (low) to blue (very high).

Predicted LDDT: 91.992 The global LDDT score (ranging from 0 to 100) predicted as an extra output of trRosettaRNA. Higher values indicate more accurate predictions.

Download the predicted structure in pdb format

Very high (≥ 90)

High (70~90)

Medium (50~70)

Low (< 50)

Predicted per-residue LDDT for the predicted structure The per-residue LDDT score (ranging from 0 to 100) predicted as an extra output of trRosettaRNA. Higher values indicate more accurate predictions.
Download predicted LDDT in CSV file
Summary of the modeling results
  • The confidence of the model is very high. It was built with the end-to-end deep learning model.
  • Download the predicted distribution of inter-nucleotide distances, which can be converted into maps with this script.
  •    Predicted inter-nucleotide distances
    Contact Distance
    between P-atoms
    Distance
    between C3'-atoms
    Distance
    between N1(9)-atoms N1 for Pyrimidine; N9 for Purine.
       Secondary structures
       Predicted by trRNA-SS
              --------10--------20--------30--------40--------50--------60--------70-
    Index:    123456789|123456789|123456789|123456789|123456789|123456789|123456789|1
    Sequence: ACCCGCAAGGCCGACGGCAAAGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU
    SS:       ((((((<((((.((((((...))))))((((((>..)<.)))))((((((..))))))>)).)).))))))
    C-Score:  0.929 (A score > 0.75 indicates a high-confidence prediction)
    Secondary structure visualized by forna
    Base Pairing Probabilities
       Extracted from the predicted 3D structure
              --------10--------20--------30--------40--------50--------60--------70-
    Index:    123456789|123456789|123456789|123456789|123456789|123456789|123456789|1
    Sequence: ACCCGCAAGGCCGACGGCAAAGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU
    SS:       (((((..(((((((((((...))))))((((((..<)..)))))((((((..))))))))).)).>)))))
    Secondary structure visualized by forna
    Base Pairing Probabilities

    Reference

  • Wang et al, The trRosettaRNA server for RNA structure prediction, Nature Protocols (2026). (PDF)
  • Wang et al, trRosettaRNA: automated prediction of RNA 3D structure with transformer network, Nature Communications, 14: 7266 (2023). (PDF)