trRosettaRNA results for the example job (your_RNA)

Download all modeling results: example_results.tar.bz2 (Note: this page will be removed after one month to save computer space)

   Predicted structure model
Color by:

Color by pLDDT from orange (low) to blue (very high).

Predicted LDDT: 91.992 The global LDDT score (ranging from 0 to 100) predicted as an extra output of trRosettaRNA. Higher values indicate more accurate predictions.

Download the predicted structure in pdb format

Very high (≥ 90)

High (70~90)

Medium (50~70)

Low (< 50)

Predicted per-residue LDDT for the predicted structure The per-residue LDDT score (ranging from 0 to 100) predicted as an extra output of trRosettaRNA. Higher values indicate more accurate predictions.
Download predicted LDDT in CSV file
Summary of the modeling results
  • The confidence of the model is very high. It was built with the end-to-end deep learning model.
    		•
  • Download the predicted distribution of inter-nucleotide distances, which can be converted into maps with this script.
    •    Predicted inter-nucleotide distances
    Contact Distance
    between P-atoms    		 Distance
    between C3'-atoms    		 Distance
    between N1(9)-atoms N1 for Pyrimidine; N9 for Purine.
       Secondary structures
       Predicted by trRNA-SS 
              --------10--------20--------30--------40--------50--------60--------70-
Index:    123456789|123456789|123456789|123456789|123456789|123456789|123456789|1
Sequence: ACCCGCAAGGCCGACGGCAAAGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU
SS:       ((((((<((((.((((((...))))))((((((>..)<.)))))((((((..))))))>)).)).))))))
C-Score:  0.929 (A score > 0.75 indicates a high-confidence prediction)
    Secondary structure visualized by forna
    		Base Pairing Probabilities
       Extracted from the predicted 3D structure 
              --------10--------20--------30--------40--------50--------60--------70-
Index:    123456789|123456789|123456789|123456789|123456789|123456789|123456789|1
Sequence: ACCCGCAAGGCCGACGGCAAAGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU
SS:       (((((..(((((((((((...))))))((((((..<)..)))))((((((..))))))))).)).>)))))
    Secondary structure visualized by forna
    		Base Pairing Probabilities
       Similar structures identified by structure search
    Structural superposition
    Predicted model vs. loading...
    Predicted model (residue index) Similar structure
    Loading structures...
    Selected match No structure selected
    Download hit PDB Open in RCSB PDB
    TM-score – model norm.
    TM-score – hit norm.
    RMSD – Å
    Sequence identity –
    Coverage –
    Top structural matches
    Click a row to update the superposition; click a column heading to sort
    View Superposition
    Loading search results...
    Download result table (CSV)

    TM-score (model norm.) is normalized by the predicted-model length
    TM-score (hit norm.) is normalized by the similar-structure length.

    Reference

  • Wang et al, The trRosettaRNA server for RNA structure prediction, Nature Protocols (2026). (PDF)
  • Wang et al, Predicting RNA 3D structure and conformers using a pre-trained secondary structure model and structure-aware attention, Nature Machine Intelligence (2026). (PDF)
  • Wang et al, trRosettaRNA: automated prediction of RNA 3D structure with transformer network, Nature Communications, 14: 7266 (2023). (PDF)