trRosettaRNA results for example

Download all modeling results: example_results.tar.bz2 (Note: this page will be removed after one month to save computer space)

   Predicted Structure Models
Color in rainbow from purple (5'-terminus) to red (3'-terminus). Estimated RMSD: 2.488 Å
Download model1 in pdb format
Summary of the modeling results
  • The confidence of the model is very high. It was built based on de novo folding, guided by deep learning restraints.
    		•
  • You can download other lower-ranked models: model2, model3, model4, model5.
  • Download the multiple sequence alignment used (with 62 homologous sequences from the RNAcentral database).
  • Download the predicted inter-nucleotide distance and orientations.
    •    Predicted inter-nucleotide distance
    Contact Distance
    between P-atoms    		 Distance
    between C3'-atoms    		 Distance
    between N1(9)-atoms
       Secondary structures
    >RNA001409
    ACCCGCAAGGCCGACGGCAAAGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU
    (((((........(((((...))))).((((((...)..)))))((((((..))))))........))))) (predicted by SPOT-RNA)
    ((((((.(((((((((((...))))))((((((...)..)))))(((((....)))))))).)).)))))) (extracted from model1.pdb)


    Predicted by SPOT-RNAExtracted from model1.pdb

    Reference

  • Wang et al, trRosettaRNA: automated prediction of RNA 3D structure with transformer network, Nature Communications, 14: 7266 (2023). (PDF)