Predicted structure model | |
Color by:
Color by pLDDT from orange (low) to blue (very high). Predicted LDDT: 91.992 The global LDDT score (ranging from 0 to 100) predicted as an extra output of trRosettaRNA. Higher values indicate more accurate predictions. Download the predicted structure in pdb format |
Very high (≥ 90) High (70~90) Medium (50~70) Low (< 50) Download predicted LDDT in CSV file |
Summary of the modeling results | |
---|---|
|
|
|
|
|
Predicted inter-nucleotide distances | ||||
![]() |
![]() between P-atoms |
![]() between C3'-atoms |
![]() between N1(9)-atoms N1 for Pyrimidine; N9 for Purine. |
Secondary structures | ||||
Predicted by trRNA-SS | ||||
---|---|---|---|---|
--------10--------20--------30--------40--------50--------60--------70- Index: 123456789|123456789|123456789|123456789|123456789|123456789|123456789|1 Sequence: ACCCGCAAGGCCGACGGCAAAGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU SS: ((((((<((((.((((((...))))))((((((>..)<.)))))((((((..))))))>)).)).)))))) C-Score: 0.929 (A score > 0.75 indicates a high-confidence prediction) |
Secondary structure visualized by forna
|
Base Pairing Probabilities |
Extracted from the predicted 3D structure | |
---|---|
--------10--------20--------30--------40--------50--------60--------70- Index: 123456789|123456789|123456789|123456789|123456789|123456789|123456789|1 Sequence: ACCCGCAAGGCCGACGGCAAAGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU SS: (((((..(((((((((((...))))))((((((..<)..)))))((((((..))))))))).)).>))))) |
Secondary structure visualized by forna
|
Base Pairing Probabilities |