trRosettaRNA results for the example job

trRosettaRNA results for the example job (your_RNA)

Download all modeling results: example_results.tar.bz2 (Note: this page will be removed after one month to save computer space)

Summary of the modeling results
Predicted structure model
Color by: pLDDT Residue Index Color by pLDDT from orange (low) to blue (very high). Spin Predicted LDDT: 91.992 The global LDDT score (ranging from 0 to 100) predicted as an extra output of trRosettaRNA. Higher values indicate more accurate predictions. Download the predicted structure in pdb format	Very high (≥ 90) High (70~90) Medium (50~70) Low (< 50) Predicted per-residue LDDT for the predicted structure The per-residue LDDT score (ranging from 0 to 100) predicted as an extra output of trRosettaRNA. Higher values indicate more accurate predictions. Download predicted LDDT in CSV file
The confidence of the model is very high. It was built with the end-to-end deep learning model.
Download the multiple sequence alignment used (with 65 homologous sequences from the RNAcentral database). click to show/hide the details
With a sequence identity cutoff of 80%, the number of effective homologous sequences (Neff) is 6.4. 63 sequences are from Rfam familiy RF02681.
Download the predicted distribution of inter-nucleotide distances, which can be converted into maps with this script.

Predicted inter-nucleotide distances
Contact	Distance between P-atoms	Distance between C3'-atoms	Distance between N1(9)-atoms N1 for Pyrimidine; N9 for Purine.

Secondary structures
Predicted by trRNA-SS
--------10--------20--------30--------40--------50--------60--------70- Index: 123456789\|123456789\|123456789\|123456789\|123456789\|123456789\|123456789\|1 Sequence: ACCCGCAAGGCCGACGGCAAAGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU SS: ((((((<((((.((((((...))))))((((((>..)<.)))))((((((..))))))>)).)).)))))) C-Score: 0.929 (A score > 0.75 indicates a high-confidence prediction)

Secondary structures

Predicted by trRNA-SS

          --------10--------20--------30--------40--------50--------60--------70-
Index:    123456789|123456789|123456789|123456789|123456789|123456789|123456789|1
Sequence: ACCCGCAAGGCCGACGGCAAAGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU
SS:       ((((((<((((.((((((...))))))((((((>..)<.)))))((((((..))))))>)).)).))))))
C-Score:  0.929 (A score > 0.75 indicates a high-confidence prediction)

Secondary structure visualized by forna

Base Pairing Probabilities

Extracted from the predicted 3D structure
--------10--------20--------30--------40--------50--------60--------70- Index: 123456789\|123456789\|123456789\|123456789\|123456789\|123456789\|123456789\|1 Sequence: ACCCGCAAGGCCGACGGCAAAGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU SS: (((((..(((((((((((...))))))((((((..<)..)))))((((((..))))))))).)).>)))))

Extracted from the predicted 3D structure

          --------10--------20--------30--------40--------50--------60--------70-
Index:    123456789|123456789|123456789|123456789|123456789|123456789|123456789|1
Sequence: ACCCGCAAGGCCGACGGCAAAGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU
SS:       (((((..(((((((((((...))))))((((((..<)..)))))((((((..))))))))).)).>)))))

Secondary structure visualized by forna

Base Pairing Probabilities

Reference

Wang et al, trRosettaRNA: automated prediction of RNA 3D structure with transformer network, Nature Communications, 14: 7266 (2023). (PDF)