RNAcontact results for job Rc000689 (your_RNA)

Sequence and secondary structure

>your_RNA

GGGCGGCUAGCUCAGCGGAAGAGCGCUCGCCUCACACGCGAGAGGUCGUAGGUUCAAGUCCUACGCCGCCCACCA

(((((((..((((.......)))).(((((.......))))).....(((((.......)))))))))))).... (-34.00)

Predicted inter-nucleotide contact map

You can click here to download the contact map.

You can click here to download the probability matrix of contacts.

You can click here to download the list of the top L predicted long-range contacts.

Please cite the following article when you use the RNAcontact server:
	S. Sun, W. Wang, Z. Peng, J. Yang, RNA inter-nucleotide contacts prediction by deep residual neural networks, Bioinformatics, 37:1093-1098, 2020.